Author Contributions
Academic Editor: Huseyin Bekir YILDIZ, Professor Doctor in Department of Materials Science and Nanotechnology Engineering, KTO Karatay University, Konya, Turkey
Checked for plagiarism: Yes
Review by: Single-blind
Copyright © 2017 Hee-Chun Chung, et al
Competing interests
The authors have declared that no competing interests exist.
Citation:
Letter
Until today, several viruses of family Bunyaviridaesuch as severe fever thrombocytopenia syndrome virus (SFTSV), Rift Valley fever virus (RVFV), Sandfly fever Naples virus (SFNV), La Crosse virus (LACV), and Bunyamwera virus (BUNV) are known as zoonotic pathogens 1, 2, 3. An outbreak of RVFV (Phlebovirus) in developed countries including U.S and Europe, could force a curtailing of livestock movement to prevent RVFV spread, causing massive loss because of high rates mortality and abortion in pregnant sheep, cattle, and goat 4. Reported cases due to LACV and BUNV, members of the genus Orthobunyavirus, have been increased in North America, South America, Africa, and Europe 1, 3. LACV, RVFV, and BUNV are transmitted by mosquitoes (Culex spp., Aedes spp., etc) which are known to prevail in Korea 5.
This study aimed to investigate the presence of LACV, RVFV, and BUNV in pigs in Korea, on the basic of regional and individual farm surveillance. From January to November, 2013, a total of 586 pig bloods were randomly collected from 45 commercial swine farms in 9 provinces (Supplementary Figure 1).
Total RNA of these samples was extracted using Trizol LS (Invitrogen, USA) following the
manufacturer’s instructions. The RNA was then converted into cDNA with the use of random hexamers and commercial M-MLV reverse transcriptase kit (Invitrogen, USA) following the manufacturer’s protocol. PCR reactions were performed with pathogen-specific primers using Maxime PCR PreMix kit (iNtRON, Korea). The specific primers (given in 5’ to 3’ direction) for each of LACV, RVFV, and BUNV are given in Supplementary Table 1 Each of viruses (LACV, RVFV, and BUNV) positive controls were used by the Bioneer, Corporation, Korea (AccuGeneBlock synthetically service).
The PCR profile was 95oC for 5 min; 38 cycles of 95oC for 20 s, 56oC for 30 s, 72oC for 40 s; and final extension at 72oC for 10 min. Of the total 586 samples, none were found to be positive with LACV, RVFV, and BUNV. Also, no positive samples were detected according to seasons of the year (Table 1).
Table 1. RT-PCR screening results according to the age and monthNo. of positive | No. of positive (positive rate %) | ||||||
Age * | (positive rate %) | Month | |||||
LACV | RVFV | BUNV | LACV | RVFV | BUNV | ||
Gilt (n=69) | 0 | 0 | 0 | January (n=42) | 0 | 0 | 0 |
Sow (n=106) | 0 | 0 | 0 | February(n=43) | 0 | 0 | 0 |
Suckling (n=96) | 0 | 0 | 0 | March (n=40) | 0 | 0 | 0 |
Weaned (n=90) | 0 | 0 | 0 | April (n=40) | 0 | 0 | 0 |
Grower (n=105) | 0 | 0 | 0 | May (n=64) | 0 | 0 | 0 |
Finisher (n=120) | 0 | 0 | 0 | June (n=72) | 0 | 0 | 0 |
July (n=79) | 0 | 0 | 0 | ||||
August (n=69) | 0 | 0 | 0 | ||||
September (n=49) | 0 | 0 | 0 | ||||
October (n=51) | 0 | 0 | 0 | ||||
November (n=37) | 0 | 0 | 0 | ||||
Grand total | 0 | 0 | 0 | Grand total | 0 | 0 | 0 |
(n=586) | (n=586) |
In conclusion, this preliminary survey found no evidence for the presence of LACV, RVFV, and BUNV in pigs, in Korea. In the next phase, attempts will be done for serological survey against the above mentioned viruses. In addition, because LACV, RVFV, and BUNV are arthropod-borne viruses, it is important to examine mosquitoes for the presence of the viruses.
Acknowledgments
This study was supported by a grant (#PJ009015) from BioGreen 21Program, Republic of Korea.
Author Disclosure Statement
No competing financial interests exist.
Supplementary data:
Virus | Primer | Targetgene | Sequence (5’-3’) | Size (bp) |
La crosse virus | LACV-F | S | GGCATTCACAGAGTCAAGCA | 361bp |
LACV-R | TTTTTGCTGTCC CCTACCAC | |||
Rift valley fever virus | RVFV-F | S | ACAAGCCCAAAAGCTTTCAA | 444bp |
RVFV-R | GAAAGAAGGCAAGGCAACG | |||
Bunyamwera virus | BUNV-F | M | CGATCACAGACTGGAAAGCA | 527bp |
BUNV-R | ACTCCTGTTGTACGCCCATC |
Supplementary Figure 1.Locations of investigated swine farms for LACV, RVFV, and BUNV.
References
- 1.Lambert A J, Blair C D, D'Anton M, Ewing W, Harborth M et al. (2010) La Crosse virus in Aedes albopictus mosquitoes. , Texas, USA, Emerging Infectious Diseases 16, 856-858.
- 2.Kim K H, Yi J, Kim G, Choi S J, Jun K I et al. (2013) Severe fever with thrombocytopenia syndrome, South Korea. , Emerging Infectious Diseases 19, 1892-1894.
- 3.Pachler K, Růžek D, Nowotny N. (2013) Molecular characterization of the African orthobunyavirus Ilesha virus. , Infection, Genetics and Evolution 20, 124-130.